Enhanced production of green fluorescent fusion proteins in a baculovirus expression system by addition of secretion signal.

Recombinant baculoviruses are widely used to express heterologous genes in insect cells (7,9). The baculovirus expression system has many advantages, such as the capacity for large DNA insertion, a high level of recombinant protein synthesis, and the production of proteins that are similar in biological activity, stability, and posttranslational modifications (e.g., glycosylation, phosphorylation, etc.) to naturally occurring proteins. The discovery of GFP has revolutionized our ability to study protein localization, dynamics, and interactions in living cells (6). The use of GFP in a baculovirus expression system allows for early and facile detection of recombinant viruses and simplifies titer determinations (2,10). Further, GFP is a robust marker for protein purification and studies of interaction. Although baculovirus expression has been used to successfully produce biologically active proteins, there are a few reports of insoluble complexes within insect cells (3,7). Indeed, we had difficulty in generating fibronectin fragments in Spodoptera frugiperda (Sf9) cells (see below). To address this issue, we created a new set of vectors to express proteins as secreted forms with N-terminal (His)6and GFP tags in the baculovirus expression system (Figure 1A). The gelatin-binding domain of rat fibronectin (Fn42k) was amplified by PCR with primers (5′-AAGGATCCGGAGTTCTACAGAGTGCTTCAGCTGG-3′ as an upstream primer and 5′-AAAAGCTTCTAGAGCAGAGGCTGGCAGTGCCACTCCC-3′ as a downstream primer) and rat fibronectin cDNA as a template (8). A BamHIHindIII digest of the PCR product was then subcloned into BglII and HindIII sites of pEGFP-C1 (BD Biosciences Clontech, Palo Alto, CA, USA). pEGFP-Fn42k was digested with NcoI and SmaI, and the resulting 1.8-kb fragment was subcloned into NcoI and EcoRV sites of pENTR11 (Invitrogen, Carlsbad, CA, USA) and then transferred to pDEST10 using the Gateway cloning system (Invitrogen). To generate a secreted form of EGFP-Fn42k, the (His)6-tagged enhanced GFP (EGFP) expression vector in E. coli cells (pQEEGFP) was first constructed by the insertion of EGFP gene (AgeI-HindIII fragment of pEGFP-C1) into XmaI/ HindIII sites of pQE30 (Qiagen, Valencia, CA, USA). A region encoding the honeybee melittin secretion signal was added as follows. (i) Two PCR products were generated with pQE-EGFP as a template using two sets of primer pairs (primer 1 & 2 and 3 & 4, primer 1: 5′-ATGGCTTCATTCAGCTCCGGTTCC-3′, primer 2: 5′-ATGTATACGACCATAAAAACAAGGGCAACGTTGACTAAGAATTTCATAGTTAATTTCTCC3′, primer 3: 5′-TGGAGTTCTGAGGTCATTACTGG-3′, primer 4: 5′-GTCGTATACATTTCTTACATCTATGCGGATCGATGGGGACATCACCATC-ACCATCACGGA-3′). (ii) The EcoRIAccI fragment of PCR product generated with primer 1 & 2 and the AccI-HindIII fragment of PCR product generated with primer 3 & 4 were subcloned into EcoRI/HindIII sites of pBluescript® II (Stratagene, La Jolla, CA, USA), and the sequence was confirmed, yielding pBSKS-MHG. To introduce a Factor Xa (New England Biolabs, Beverly, MA, USA) cleavage site between EGFP and the protein of interest, another reaction was performed with T7 promoter primer and primer 5 (5′-TATCCGGACCGACCCTCGATCBenchmarks